Τελευταία Νέα

Πανελλαδικές 2020 – Τα θέματα και οι απαντήσεις των θεμάτων σε Βιολογία και Κοινωνιολογία

Οι απαντήσεις στην Κοινωνιολογία

Τα θέματα της Κοινωνιολογίας, εδώ

ΘΕΜΑ Α

Α1.

α.Λ

β.Σ

γ.Σ

δ.Λ

ε.Σ

Α2.

1.α

2.β

ΘΕΜΑ Β

Β1

Ο Ε. Γκόφμαν μελέτησε την αλληλεπίδραση στις καθημερινές και πολλές φορές φευγαλέες συναντήσεις των ανθρώπων. Διέκρινε την κοινωνική ζωή σε στιγμές που λαμβάνουν χώρα στο προσκήνιο και σε στιγμές που λαμβάνουν χώρα στο παρασκήνιο. Στο προσκήνιο γίνονται όλες εκείνες οι συναντήσεις κατά τις οποίες τα άτομα υποδύονται τυπικούς ρόλους. Είναι στιγμές που θεωρούνται «παραστάσεις επί σκηνής» και που συχνά απαιτούν τη συνεργασία με άλλα άτομα. Για παράδειγμα, δύο πολιτικοί από το ίδιο κόμμα μπορεί να δείξουν μπροστά στην κάμερα της τηλεόρασης αγαπημένοι και φίλοι, παρά το γεγονός ότι αντιπαθούν ο ένας τον άλλο.Ένα αντρόγυνο μπροστά στα παιδιά του δείχνει ότι είναι αγαπημένο όταν κοιμούνται όμως τα παιδιά, ξεσπάάγριος καβγάς.

Από την άλλη πλευρά, όταν οι άνθρωποι βρίσκονται στα «παρασκήνια», χαλαρώνουν και εκδηλώνουνελεύθερα τα συναισθήματά τους, αλλά και τρόπους συμπεριφοράς που κρατούν σε έλεγχο όταν βρίσκονται «πάνω στη σκηνή». Σε αυτές τις στιγμές της χαλάρωσης επιτρέπονται πράγματα που δεν επιτρέπονται «επί σκηνής» όπως, για παράδειγμα, οι απροκάλυπτες σεξουαλικές κουβέντες, το ατημέλητο ντύσιμο, η χρήση κάποιας διαλέκτου, πειράγματα και τολμηρές χειρονομίες, αγενείς προς τους άλλους ενέργειες που αποφεύγονται μπροστά στο κοινό.

Β2.

Άλλοτε πάλι η ανάπτυξη των κοινωνιών ταυτίζεται με την ενσωμάτωσή τους στη διεθνή αγορά και τον παγκόσμιο καπιταλισμό. Οι θεμελιωτές της άποψης αυτής, που έγινε γνωστή ως θεωρία της εξάρτησης,

υποστηρίζουν ότι η ανάπτυξη του καπιταλιστικού δυτικού κόσμου και η υπανάπτυξη του Τρίτου Κόσμου πρέπει να εξετάζονται από κοινού. Με άλλα λόγια, οι χώρες του Τρίτου Κόσμου δεν μπόρεσαν να αναπτυχθούν αυτόνομα, επειδή προσδέθηκαν στο άρμα του καπιταλισμού με σχέση εξάρτησης. Έτσι, οι δυτικές χώρες εξελίχθηκαν σε καπιταλιστικές δυνάμεις όχι μόνο μέσα από την ιδιοποίηση της υπεραξίας των δικών τους εργατών, αλλά και μέσα από την ιδιοποίηση και εκμετάλλευση των πλουτοπαραγωγικών πηγών και των φθηνών εργατικών χεριών των χωρών του Τρίτου Kόσμου. Με αυτό τον τρόπο έχει δημιουργηθεί ένα σύστημα στο οποίο οι αναπτυγμένες χώρες (Η.Π.Α., Ιαπωνία) λειτουργούν ως μια παγκόσμια καπιταλιστική τάξη (η οποία αναφέρεται ως «μητρόπολη», «κέντρο» ή «πυρήνας»), ενώ οι λιγότερο αναπτυγμένες χώρες (οι οποίες αναφέρονται ως «περιφέρεια») παίζουν το ρόλο της εργατικής τάξης που υφίσταται την εκμετάλλευση σε διεθνές επίπεδο. Ωστόσο, παρά την οικονομική αλληλεξάρτηση των χωρών, οι ανισότητες μεγεθύνονται και δεν υπάρχει ένδειξη προς το παρόν ότι θα πάψουν να υφίστανται τα αντικρουόμενα συμφέροντα των κρατών. Ο περιορισμός των ανισοτήτων ανάμεσα στις χώρες αποτελεί μια πρόκληση για την παγκόσμια κοινωνία.

Γ.1 Να ορίσετε τις έννοιες «πολιτική συμπεριφορά» και «πολιτική αλλοτρίωση».

Με τον όρο «πολιτική συμπεριφορά» εννοούμε τον τρόπο με τον οποίο το άτομο εκφράζει, δραστηριοποιείται και συμμετέχει ως πολίτης σε συλλογικές διαδικασίες, σε σωματεία, συλλόγους, εθελοντικές οργανώσεις, λέσχες, κόμματα και εκλογικές διαδικασίες.

Με τον όρο «πολιτική αλλοτρίωση» εννοούμε την αποξένωση, την αδιαφορία, την αίσθηση του ατόμου ότι η συμμετοχή του στο πολιτικό γίγνεσθαι δε μετρά, τη δυσπιστία του έναντι των κυβερνώντων και γενικά την απομάκρυνσή του από τις πολιτικές διαδικασίες και τις πολιτικές εξελίξεις.

Γ.2 Να εξηγήσετε από κοινωνιολογική σκοπιά τα αίτια της πολιτικής αλλοτρίωσης.

Τα αίτια της πολιτικής αλλοτρίωσης θα πρέπει κανείς να τα δει κοινωνιολογικά. Η συνθετότητα των σύγχρονων κοινωνιών, η παγκοσμιοποίηση, οι υπερκρατικοί θεσμοί και η δημιουργία διεθνών κέντρων λήψης αποφάσεων μειώνουν την αμεσότητα της επικοινωνίας μεταξύ των κυβερνώντων και των πολιτών και μπορεί να επιτείνουν την αλλοτρίωση. Καθοριστικό ρόλο στην πολιτική αλλοτρίωση των ατόμων διαδραματίζουν και άλλοι κοινωνικοί, οικονομικοί και πολιτικοί παράγοντες, όπως είναι ο σύγχρονος καταναλωτισμός και ο καριερισμός/επαγγελματισμός, ο οποίος είναι ιδιαίτερα έντονος σε περιόδους ανεργίας και οικονομικής ύφεσης κατά τις οποίες ο ανταγωνισμός είναι μεγαλύτερος.

Γ.3 Με ποιους τρόπους μπορεί να αντιμετωπιστεί η πολιτική αλλοτρίωση;

Πώς αντιμετωπίζεται η πολιτική αλλοτρίωση; Και εδώ οι προσπάθειες θα πρέπει να είναι συλλογικές. Οι κυβερνώντες με την πολιτική τους (όπως είναι ο πραγματικός έλεγχος της διαπλοκής, η εξάλειψη των πελατειακών σχέσεων και η καθιέρωση της αξιοκρατίας) μπορούν να συμβάλουν στην εγκαθίδρυση ενός κρά- τους δικαίου, ώστε να ανακτήσουν την εμπιστοσύνη των πολιτών. Ωστόσο, πρωτοβουλίες για την αντιμετώπιση της πολιτικής αλλοτρίωσης μπορούν να πάρουν και οι ίδιοι οι πολίτες. Αντιλήψεις όπως «η ψήφος μου δε μετράει» αφήνουν το πολιτικό πεδίο ελεύθερο στις ελίτ, οι οποίες θα προωθήσουν τα συμφέροντα των λίγων. Όπως, για παράδειγμα, στο σχολείο κάθε μαθητής και κάθε μαθήτρια συμμετέχει στις εκλογές των συμβουλίων (είτε ως ψηφοφόρος είτε ως υποψήφιος/α) προκειμένου να εκλεγεί ο ικανότερος ή η ικανότερη που θα διαμεσολαβεί μεταξύ της διεύθυνσης του σχολείου και των μαθητών, έτσι και στην ευρύτερη κοινωνία επιβάλλεται η συμμετοχή όλων στις πολιτικές διαδικασίες, ώστε να εκφράζονται με μεγαλύτερη δύναμη τα αιτήματα των πολιτών. Η δημοκρατία βέβαια βιώνεται αρχικά μέσα στην οικογένεια. Στο πλαίσιο της οικογένειας διεξάγονται συζητήσεις, επιλύονται προβλήματα, αποτρέπονται συγκρούσεις και συχνά διατυπώνονται από τα παιδιά αιτήματα προς τους γονείς. Επιπλέον, η ισότιμη για αγόρια και κορίτσια συμμετοχή στις οικιακές εργασίες μπορεί να είναι το προστάδιο για μια ισότιμη συμμετοχή στις πολιτικές διαδικασίες. Η διαρκής συμμετοχή των πολιτών στις πολιτικές διαδικασίες (στις οργανώσεις, τα κόμματα, τις εκλογές κτλ.) είναι ιδιαίτερα επιτακτική στις σύγχρονες αντιπροσωπευτικές δημοκρατίες Με αυτό τον τρόπο ελέγχεται η εξουσία και κατοχυρώνεται στην πράξη η αντιπροσωπευτική δημοκρατία.

ΟΜΑΔΑ Δ

Δ1.

i) Ο Γερμανός κοινωνιολόγος Βέμπερ ασχολήθηκε με πολλά κοινωνικά ζητήματα όπως, για παράδειγμα, με τις έννοιες της δύναμης και της εξουσίας, με τις θρησκείες ανά τον κόσμο, με τη βαθύτερη φύση των κοινωνικών τάξεων, καθώς και με την ανάπτυξη της γραφειοκρατίας ως κοινωνικού φαινομένου. Χάρη στην ποιότητα της σκέψης και του έργου του, αλλά και της ποικιλίας των ενδιαφερόντων του, ο Βέμπερ είχε καθοριστική επιρροή στην ανάπτυξη της κοινωνιολογίας. Θεώρησε τον εξορθολογισμό ως ένα κλειδί που μας επιτρέπει να δούμε τη μετάβαση από την προβιομηχανική στην καπιταλιστική βιομηχανική κοινωνία. Ο ορθολογισμός είναι αυτός που δίνει έμφαση στη λογική και τον προγραμματισμό. Το σύστημα εξορθολογισμού είναι απρόσωπο, λειτουργεί στο πλαίσιο τυπικών κανόνων και απετέλεσε το κύριο χαρακτηριστικό του καπιταλισμού και του δυτικού πολιτισμού. Χαρακτηριστικότερο παράδειγμα εξορθολογισμού είναι η περίπτωση της οικονομικής δραστηριότητας: η οργάνωση της καπιταλιστικής επιχειρηματικής δραστηριότητας χαρακτηρίζεται από ορθολογική οργάνωση της εργασίας μέσα στο εργοστάσιο, αλλά και από ορθολογική εκτίμηση των ευκαιριών στην αγορά. Ο Βέμπερ θεώρησε ότι ο ορθολογικός τρόπος δράσης και οργάνωσης που καθορίζει όλους τους τομείς της καπιταλιστικής κοινωνίας (οικονομία, κράτος, νομικοί θεσμοί, γραφειοκρατία κτλ.) στηρίχτηκε στην επιστήμη και εξελίχτηκε παράλληλα με την επικράτηση της τεχνολογίας. Στις προβιομηχανικές κοινωνίες κυριαρχούσε η προκατάληψη, το συναίσθημα και η τύχη. Έτσι, η γεωργική παραγωγή καθοριζόταν από τη μοίρα ή άλλες υπερφυσικές δυνάμεις. Η επικράτηση του καπιταλισμού είχε ως αποτέλεσμα, μεταξύ άλλων, την υποχώρηση των θρησκευτικών και των ηθικών αξιών, καθώς και των παραδοσιακών τρόπων προσανατολισμού της δράσης των ανθρώπων που κυριαρχούσαν στις προκαπιταλιστικές κοινωνίες.

ii) Ο Γάλλος κοινωνιολόγος Ντυρκέμ υποστήριζε ότι η κοινωνία είναι μια ηθική ενότητα ανθρώπων, οι οποίοι μοιράζονται τα ίδια συναισθήματα και την ίδια προσήλωση σε αξίες και κανόνες. Το σύνολο των αξιών και των κανόνων συγκροτεί τη «συλλογική συνείδηση», η οποία καθορίζει τη συμπεριφορά των ανθρώπων και διακρίνει μια κοινωνία. Η κοινωνική συνοχή των μελών μιας κοινωνίας εκφράζεται ως «κοινωνική αλληλεγγύη». Οι προβιομηχανικές κοινωνίες

στηρίζονταν σε αυτό που ο Ντυρκέμ ονόμασε μηχανική αλληλεγγύη, που σημαίνει μεγάλη κοινωνική ομοιομορφία, συνοχή και συναίνεση γύρω από τις αξίες και τις πεποιθήσεις. Σ’ αυτές τις κοινωνίες υπήρχε επίσης πίεση για υπακοή στους κανόνες και μεγάλη εξάρτηση από τις παραδόσεις και την οικογένεια. Αντίθετα, οι βιομηχανικές κοινωνίες στηρίζονται σε αυτό που ο Ντυρκέμ ονόμασε οργανική αλληλεγγύη η οποία βασίζεται στον υψηλό καταμερισμό εργασίας ανάμεσα σε εξειδικευμένους ρόλους. Ο υψηλός καταμερισμός εργασίας ωθεί τα μέλη των κοινωνιών αυτών στην αλληλεξάρτηση και στην ανταλλαγή αγαθών και υπηρεσιών.

Δ2. Ένα άλλο είδος δύναμης κατά το Γερμανό κοινωνιολόγο είναι η κοινωνική επιβολή ή η εξουσία. Η εξουσία απαιτεί τη χρήση βίας (καταναγκασμού) ή την απειλή χρήσης βίας για την άσκηση ελέγχου. Βέβαια, στις οργανωμένες κοινωνίες δυτικού τύπου στις οποίες ζούμε η χρήση φυσικής βίας από ιδιώτη ή ακόμη από οργανωμένη ομάδα είναι παράνομη. Η μόνη αρχή που νομιμοποιείται να ασκήσει βία είναι η κεντρική πολιτική αρχή και οι μηχανισμοί της, στους οποίους εμπιστεύεται το δικαίωμα αυτό. Αυτή η κεντρική πολιτική αρχή είναι το κράτος, που κατέχει, σύμφωνα με τον Βέμπερ, το μονοπώλιο της έννομης βίας. Έτσι, ορίζει το κράτος ως την «κοινότητα των ανθρώπων η οποία αξιώνει (αποτελεσματικά) το μονοπώλιο στη χρήση της νόμιμης φυσικής βίας μέσα σε ένα ορισμένο έδαφος». Η δημιουργία του κράτους είναι μια διαδικασία συνεχούς ορθολογικοποίησης, της οποίας τα χαρακτηριστικά κατά τον Βέμπερ είναι τα εξής:

• συγκρότηση ενός σώματος μόνιμων και ειδικών υπαλλήλων (γραφειοκρατία), • ορισμός μόνιμων διαδικασιών διαχείρισης και ελέγχου, • προσδιορισμός μιας εμφανούς ιεραρχίας αρμοδιοτήτων

Δ3. Για την κοινωνιολογία η θρησκεία αποτελεί έναν κοινωνικό θεσμό που πραγματεύεται τη σχέση των ανθρώπων με το θείο. Αναφέρουμε παρακάτω, ενδεικτικά κάποιες από τις σκέψεις των θεμελιωτών της κοινωνιολογίας σχετικά με τη θρησκεία που αφορούν την κοινωνική ένταξη και την κοινωνικοποίηση του ατόμου. Σύμφωνα με τον Ντυρκέμ (Ε. Durkheim, 1858-1917), η θρησκεία αποτελεί προβολή και θεοποίηση της ίδιας της ανθρώπινης κοινωνίας. Μέσα από τη διδασκαλία του θρησκευτικού δόγματος και τις θρησκευτικές τελετές επιβεβαιώνεται η συλλογική ταυτότητα των ομοθρήσκων (π.χ. «εμείς οι χριστιανοί», «εμείς οι μουσουλμάνοι», «εμείς οι εβραίοι») και ενισχύονται τα ιδανικά και οι αξίες της κοινωνίας. Η θρησκεία είναι στενά συνδεδεμένη με την εμπειρία της κοινότητας* γιατί ενισχύει τους δεσμούς μεταξύ των μελών της και ενώνει τους ομοθρήσκους. Σύμφωνα με τη σύγχρονη λειτουργιστική θεωρία, η οποία αναμφίβολα έχει επηρεαστεί από τη σκέψη του Ντυρκέμ, η θρησκεία αποτελεί το φορέα κοινωνικοποίησης που συντείνει στη σύνδεση των μελών και εν τέλει στην ενοποίηση και συνοχή της κοινωνίας με διάφορους τρόπους: α. Επηρεάζει τα πρότυπα συμπεριφοράς των ομόθρησκων ατόμων. β. Διαμορφώνει τους κοινωνικούς κανόνες και τις συμπεριφορές τους. γ. Δραστηριοποιείται με παρεμβάσεις κοινωνικού περιεχομένου (π.χ. δωρεά οργάνων, συσσίτια για απόρους, προγράμματα για νέους).

Νέο Φροντιστήριο: 52 χρόνια επιτυχίες

Ο όμιλος Νέο Φροντιστήριο, ιδρύθηκε το 1968 & σήμερα  αριθμεί πάνω από 80 εκπαιδευτικά κέντρα με 600 καθηγητές, 100 συνεργάτες διευθυντές σπουδών κάθε ειδικότητας, πλήρη σειρά εκδόσεων και πλούσιο ηλεκτρονικό εκπαιδευτικό υλικό. Η πλούσια ακαδημαϊκή του παράδοση διατηρείται αναλλοίωτη, αφού οι άνθρωποι του βρίσκονται σε συνεχή εγρήγορση αφουγκραζόμενοι τις νέες εξελίξεις & προκλήσεις της εποχής, κάτι που επιβεβαιώθηκε περίτρανα στην πρόσφατη περιπέτεια της πανδημίας.   Η  διαχρονική πρωτοκαθεδρία του οργανισμού στην προετοιμασία των μαθητών για την τριτοβάθμια εκπαίδευση, ανεξαρτήτως του τρόπου εισαγωγής τους, καταδεικνύεται από τα αποτελέσματα, αφού κάθε χρόνο πάνω από 1200 μαθητές των  φροντιστηρίων μας εισάγονται στην Τριτοβάθμια Εκπαίδευση. Υπολογίζεται ότι πάνω από 60000 σημερινοί επιστήμονες πέρασαν από τα θρανία του όλα αυτά τα χρόνια!

Σχολιασμός των θεμάτων του μαθήματος της Βιολογίας από την ομάδα των Βιολόγων του Νέου Φροντιστηρίου

Μετά από μια ιδιαίτερη χρονιά, από πολλές απόψεις, οι υποψήφιοι κλήθηκαν σήμερα να αντιμετωπίσουν το μάθημα της Βιολογίας… Φέτος, για πρώτη φορά οι μαθητές αντιμετώπισαν από κοινού τη Βιολογία Προσανατολισμού και τη Βιολογία Γενικής Παιδείας..

Τα θέματα, αν και παρουσίαζαν κλιμακωτή δυσκολία και αρκετή έκταση, κινούνται στα όρια του αναμενόμενου και η αρχική εκτίμηση είναι πως οι καλά προετοιμασμένοι υποψήφιοι μπορούν να ανταποκριθούν ικανοποιητικά..

Οι ερωτήσεις πολλαπλής επιλογής του πρώτου θέματος απαιτούσαν γνώση από την πλευρά των μαθητών και κατανόηση του υλικού και των δύο βιβλίων, χωρίς όμως να παρουσιάζουν κάποια ιδιαίτερη δυσκολία.

Στο δεύτερο θέμα οι ερωτήσεις θεωρίας, προερχόμενες από την ύλη και των δύο βιβλίων, κρίνονται αναμενόμενες και με απαντήσεις σχετικά μικρής έκτασης…

Στο τρίτο θέμα ο βαθμός δυσκολίας ανεβαίνει.. Η ερώτηση διαγράμματος αντιγόνου και η άσκηση 2ου κεφαλαίου από το βιβλίο της Γενικής δεν αποτελούν έκπληξη. Τα ερωτήματα Γ3 και Γ4, από την ύλη του Προσανατολισμού, απαιτούν κάποια προσοχή παραπάνω…Καλή και σε βάθος κατανόηση της εκφώνησης, γνώση και κριτική ικανότητα από την πλευρά των υποψηφίων θεωρούνται απαραίτητα για την ολοκληρωμένη απάντηση αυτών των υποερωτημάτων…

Τέλος, το τέταρτο θέμα αποτελεί ίσως την μόνη «πρόκληση» των σημερινών θεμάτων…Τα υποερωτήματα του συγκεκριμένου θέματος απαιτούσαν σε βάθος γνώση, απόλυτη κατανόηση και συνδυαστική σκέψη από την πλευρά των υποψηφίων. Ήταν το θέμα που απαιτούσε τον περισσότερο χρόνο και αυτό που ανεβάζει τον πήχη της δυσκολίας των φετινών θεμάτων λίγο παραπάνω από τα αντίστοιχα των περσινών εξετάσεων…

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ

EΠΙΜΕΛΕΙΑ ΑΠΑΝΤΗΣΕΩΝ: ΓΙΩΤΑ ΠΑΠΠΑ, ΑΝΤΩΝΗΣ ΒΥΛΛΙΩΤΗΣ, ΓΙΩΡΓΟΣ ΖΩΗΣ, ΒΕΛΙΣΣΑΡΙΟΣ ΚΥΤΡΙΔΗΣ

ΘΕΜΑ Α

A1. B

A2. A

A3 . Δ

Α4. Α

Α5. Γ

Β1.

Αριθμός Χρωμοσωμάτων Αριθμός μορίων DNA πυρήνα
Μετάφαση μίτωσης 48 96
Θυγατρικό κύτταρο που προκύπτει από την Μείωση Ι 24 48

Β2.

Σελ 63 Γενικής

Το πεπτικό σύστημα επιβαρύνεται επίσης, καθώς το οινόπνευμα προκαλεί αύξηση των εκκρίσεων του στομάχου και στη συνέχεια φλεγμονή. Παράλληλα, η υπερβολική κατανάλωση οινοπνεύματος ελαττώνει την ικανότητα του λεπτού εντέρου να απορροφά τις θρεπτικές ουσίες που περιέχονται στην τροφή μας. Συνέπεια του γεγονότος αυτού είναι η φθορά του ήπατος, το οποίο, αντί να αποθηκεύει τις πρωτεΐνες και τους υδατάνθρακες που χρησιμοποιούνται από τα ηπατικά κύτταρα, αποθηκεύει λίπη, με αποτέλεσμα τη διόγκωσή του. Η συνεχιζόμενη κατανάλωση οινοπνεύματος από έναν αλκοολικό καταλήγει συχνά σε εκφυλισμό του ηπατικού ιστού, μια κατάσταση που ονομάζεται κίρρωση του ήπατος, η οποία, αν και δεν περιορίζεται στους αλκοολικούς, παρουσιάζεται ωστόσο σε ποσοστό οκτώ φορές μεγαλύτερο σ’ αυτούς παρά στα μη εξαρτημένα από το αλκοόλ άτομα. Η κατάχρηση του αλκοόλ προκαλεί υπέρταση και έτσι αυξάνει τις πιθανότητες για την εμφάνιση καρδιαγγειακών νοσημάτων. Το αλκοόλ όμως συσχετίζεται και με την αύξηση της πιθανότητας να εκδηλωθούν διάφορες μορφές καρκίνου (στομάχου, ήπατος, πνευμόνων), ενώ σε συνδυασμό με τη νικοτίνη ευθύνεται για καρκίνους του λάρυγγα και του οισοφάγου.

Β3.

  1. Σελ 13-14 Γενικής

Τα βακτήρια αναπαράγονται κυρίως μονογονικά με απλή διχοτόμηση. Η αναπαραγωγή τους διαρκεί μικρό χρονικό διάστημα. Ορισμένα βακτήρια, σε ευνοϊκές γι’ αυτά συνθήκες, διαιρούνται κάθε 20 λεπτά. Σε αντίξοες συνθήκες, όπως σε ακραίες θερμοκρασίες ή υπό τη δράση ακτινοβολιών, πολλά βακτήρια μετατρέπονται σε ανθεκτικές μορφές, τα ενδοσπόρια. Τα ενδοσπόρια είναι αφυδατωμένα κύτταρα με ανθεκτικά τοιχώματα και χαμηλούς μεταβολικούς ρυθμούς. Όταν οι συνθήκες του περιβάλλοντος ξαναγίνουν ευνοϊκές, τα ενδοσπόρια βλαστάνουν δίνοντας το καθένα ένα βακτήριο.

  1. Οι μηχανισμοί με τους οποίους ένα κύτταρο «ξυπνά» ένα «κοιμισμένο» γονίδιο είναι οι πιο σημαντικοί και πολύπλοκοι της Μοριακής Βιολογίας. Οι αρχικές μελέτες της ρύθμισης των γονιδίων έγιναν από τους Jacob και Monod, το 1961. Οι ερευνητές περιέγραψαν την ικανότητα του βακτηρίου Ε. coli να παραγάγει τα τρία απαραίτητα ένζυμα που χρειάζεται για να μεταβολίσει το δισακχαρίτη λακτόζη, όταν δεν υπάρχει γλυκόζη στην τροφή του. Οι Jacob και Monod απέδειξαν με γενετικές μελέτες ότι τα γονίδια που κωδικοποιούν τα τρία αυτά ένζυμα βρίσκονται το ένα δίπλα στο άλλο πάνω στο γονιδίωμα του βακτηρίου και αποτελούν μια μονάδα, που την ονόμασαν οπερόνιο της λακτόζης. Σε αυτό περιλαμβάνονται εκτός από αυτά τα γονίδια, που ονομάζονται δομικά, και αλληλουχίες DNA που ρυθμίζουν τη μεταγραφή τους. Οι αλληλουχίες αυτές που βρίσκονται μπροστά από τα δομικά γονίδια είναι κατά σειρά ένα ρυθμιστικό γονίδιο, ο υποκινητής και ο χειριστής. Το οπερόνιο της λακτόζης δε μεταγράφεται ούτε μεταφράζεται, όταν απουσιάζει από το θρεπτικό υλικό η λακτόζη. Τότε λέμε ότι τα γονίδια που το αποτελούν βρίσκονται υπό καταστολή. Πώς επιτυγχάνεται η καταστολή; Δύο είναι τα ρυθμιστικά μόρια: μια αλληλουχία DNA, που ονομάζεται χειριστής και βρίσκεται μεταξύ του υποκινητή και του πρώτου γονιδίου, και μια ρυθμιστική πρωτεΐνη-καταστολέας. Όταν στο θρεπτικό υλικό υπάρχει μόνο λακτόζη, τότε ο ίδιος ο δισακχαρίτης προσδένεται στον καταστολέα και δεν του επιτρέπει να προσδεθεί στο χειριστή. Τότε η RNA πολυμεράση είναι ελεύθερη να αρχίσει τη μεταγραφή. Δηλαδή η λακτόζη λειτουργεί ως επαγωγέας της μεταγραφής των γονιδίων του οπερονίου. Τότε τα γονίδια αρχίζουν να «εκφράζονται», δηλαδή να μεταγράφονται και να συνθέτουν τα ένζυμα. Τα τρία ένζυμα μεταφράζονται ταυτόχρονα από το ίδιο μόριο mRNA το οποίο περιέχει κωδικόνιο έναρξης και λήξης για κάθε ένζυμο (Εικόνα 2.13β). Συμπερασματικά, η ίδια η λακτόζη ενεργοποιεί τη διαδικασία για την αποικοδόμησή της. Όταν η λακτόζη διασπαστεί πλήρως, τότε η πρωτεΐνη καταστολέας είναι ελεύθερη να προσδεθεί στο χειριστή και να καταστείλει τη λειτουργία των τριών γονιδίων.
  2. Στο γονιδίωμα των προκαρυωτικών οργανισμών τα γονίδια των ενζύμων που παίρνουν μέρος σε μια μεταβολική οδό, όπως η βιοσύνθεση διάφορων αμινοξέων, οργανώνονται σε οπερόνια, δηλαδή σε ομάδες που υπόκεινται σε κοινό έλεγχο της έκφρασής τους.

Β4. Ο αλφισμός οφείλεται στην έλλειψη ενός ενζύμου, το οποίο είναι απαραίτητο για το σχηματισμό της χρωστικής μελανίνης. Στα άτομα που πάσχουν από αλφισμό υπάρχει έλλειψη της χρωστικής στο δέρμα, στα μαλλιά και στην ίριδα του οφθαλμού. Ο αλφισμός εμφανίζει ετερογένεια, δηλαδή άλλα άτομα εμφανίζουν παντελή έλλειψη ενεργότητας του ενζύμου, ενώ άλλα εμφανίζουν μειωμένη ενεργότητα.

Είναι γνωστό ότι στα διπλοειδή κύτταρα υπάρχουν δύο αλληλόμορφα για μία ορισμένη γενετική θέση, ενώ ένα απλοειδές κύτταρο, όπως ένας γαμέτης, έχει μόνο ένα. Εντούτοις, εάν εξετάσουμε έναν πληθυσμό ατόμων μπορεί να βρούμε περισσότερα από δύο αλληλόμορφα για μία γενετική θέση. Εάν στον πληθυσμό υπάρχουν τρία ή περισσότερα αλληλόμορφα για μία γενετική θέση, τότε αυτά ονομάζονται πολλαπλά αλληλόμορφα. Πολλά γονίδια που ευθύνονται για τη δημιουργία ασθενειών έχουν πολλαπλά αλληλόμορφα γονίδια, όπως συμβαίνει στη β-θαλασσαιμία. Συνήθως κάθε αλληλόμορφο του φυσιολογικού γονιδίου σχετίζεται με διαφορετική μορφή της ίδιας ασθένειας, ήπια ή σοβαρή.

Β5.

Αμετάφραστες περιοχές

Κωδικόνιο λήξης

Γονίδια tRNA

Γονίδια rRNA

Γ1.

Β: Πρωτογενής ανοσοβιολογική απόκριση

Α: Πρωτογενής ανοσοβιολογική απόκριση

Γ: Δευτερογενής ανοσοβιολογική απόκριση

 

 

pyramides-1.jpg

Γ3.

1η περίπτωση: Έστω οτι το γονίδιο που είναι υπεύθυνο για την παραγωγή της πρωτεϊνης Α βρίσκεται στο μιτοχονδριακό DNA.

Στη περίπτωση αυτή θα πάσχουν όλοι οι απόγονοι του ζευγαριού διότι το ζυγωτό των ανώτερων οργανισμών περιέχει μόνο τα μιτοχόνδρια που προέρχονται από το ωάριο, επομένως, η προέλευση των μιτοχονδριακών γονιδίων είναι μητρική.

2η περίπτωση: Έστω οτι το γονίδιο που είναι υπεύθυνο για την παραγωγή της πρωτεϊνης Α βρίσκεται στο πυρηνικό DNA.

Με δεδομένο ότι η συχνότητα εμφάνισης της ασθένειας είναι ίδια τα αρσενικά και στα θηλυκά άτομα του πληθυσμού συμπεραίνουμε ότι ο τρόπος κληρονόμησης δεν είναι φυλοσύνδετος.

Α) Έστω οτι το γονίδιο που είναι υπεύθυνο για την παραγωγή της πρωτεϊνης Α είναι αυτοσωμικό υπολειπόμενο.

Α: Επικρατές αλληλόμορφο γονίδιο υπεύθυνο για την μη παραγωγή της φυσιολογικής πρωτεϊνης Α.

α: Υπολειπόμενο αλληλόμορφο γονίδιο υπεύθυνο για την παραγωγή της φυσιολογικής πρωτεϊνης Α.

Γυναίκα: ΑΑ ή Αα

Άνδρας: αα

Πιθανότητα οι απόγονοι να πάσχουν είναι 100% και 50% αντίστοιχα.

Β) Έστω οτι το γονίδιο που είναι υπεύθυνο για την παραγωγή της πρωτεϊνης Α είναι αυτοσωμικό επικρατές.

Α: Επικρατές αλληλόμορφο γονίδιο υπεύθυνο για την παραγωγή της φυσιολογικής πρωτεϊνης Α.

α: Υπολειπόμενο αλληλόμορφο γονίδιο υπεύθυνο για την μη παραγωγή της φυσιολογικής πρωτεϊνης Α.

Γυναίκα: αα

Άνδρας: ΑΑ ή Αα

Πιθανότητα οι απόγονοι να πάσχουν είναι 0% και 50% αντίστοιχα.

 

Γ4.

Μετά από 3 κύκλους αντιγραφής θα υπάρχουν συνολικά 8 αντίγραφα του αρχικού μορίου DNA, εκ των οποίων τα 6 θα αποτελούνται αποκλειστικά από ραδιενεργό 15Ν. Είναι γνωστό πως μετά το πέρας της αντιγραφής ενός μορίου DNA τα δύο θυγατρικά μόρια που προκύπτουν είναι πανομοιότυπα με το μητρικό και καθένα αποτελείται από μία παλιά και μία καινούρια αλυσίδα. Ο μηχανισμός αυτός ονομάζεται ημισυντηρητικός. Επομένως το ποσοστό μορίων που θα περιέχουν αποκλειστικά 15Ν θα είναι τα 6/8 δηλαδή το 75% των μορίων.

 

ΘΕΜΑ Δ Δ1. Γονίδιο Α mRNA 5’ GAAUUCGGAACAUGCCCGGGUCAGCCUGAGAGAAUUCCC 3’

Δ2. Γονίδιο Γ Εφόσον το tRNA μεταφέρει μεθειονίνη διαθέτει αντικωδικόνιο 3’UAC 5’ συμπληρωματικό ως προς το κωδικόνιο 5’ AUG3’ της μεθειονίνης. Άρα, η μη μεταγραφόμενη αλυσίδα του γονιδίου που κωδικοποιεί το συγκεκριμένο tRNA πρέπει να περιλαμβάνει την τριάδα 5’CAT3’.

Δ3. Γονίδιο Β Εφόσον, το mRNA διαθέτει την αλληλουχία 5’GGAAC 3’ στην 5’ αμετάφραστη περιοχή του, το rRNA πρέπει να διαθέτει στην αλληλουχία του την πεντάδα 3’ CCUUG 5’. Άρα, το γονίδιο που κωδικοποιεί το συγκεκριμένο rRNA πρέπει να διαθέτει στη μεταγραφόμενη αλυσίδα του την πεντάδα 5’ GGAAC 3’.

Δ4. i) ΠΕ-Ι η οποία τέμνει το πλασμίδιο και EcoRI που απομονώνει το γονίδιο. ii) 5’ CAATTC …………………….GAATTG 3’ 3’ GTTAAG……………………..CTTAAC 5’ iii) Το ανασυνδυασμένο πλασμίδιο δεν διαθέτει την αλληλουχία αναγνώρισης της ΠΕ-Ι…Άρα, το ένζυμο αυτό δεν επιδρά.

 

Δείτε εδώ τα θέματα των εξετάσεων:

Κοινωνιολογία

Βιολογία

Με το παλαιό σύστημα

Βιολογία Γενικής Παιδείας – Ημερήσια

Βιολογία Γενικής Παιδείας – Εσπερινά

Ακολουθούν την επόμενη εβδομάδα, η εξέταση στη Φυσική στις 22 Ιουνίου και στις 24 Ιουνίου στην Ιστορία και την Πληροφορική. Το πρόγραμμα ολοκληρώνεται με την εξέταση στις 26 Ιουνίου στην Χημεία (ΟΠ Θετικών Σπουδών και Σπουδών Υγείας) και την Οικονομία (ΟΠ Σπουδών Οικονομίας και Πληροφορικής).

Νέο Φροντιστήριο: 52 χρόνια επιτυχίες

Ο όμιλος Νέο Φροντιστήριο, ιδρύθηκε το 1968 & σήμερα  αριθμεί πάνω από 80 εκπαιδευτικά κέντρα με 600 καθηγητές, 100 συνεργάτες διευθυντές σπουδών κάθε ειδικότητας, πλήρη σειρά εκδόσεων και πλούσιο ηλεκτρονικό εκπαιδευτικό υλικό. Η πλούσια ακαδημαϊκή του παράδοση διατηρείται αναλλοίωτη, αφού οι άνθρωποι του βρίσκονται σε συνεχή εγρήγορση αφουγκραζόμενοι τις νέες εξελίξεις & προκλήσεις της εποχής, κάτι που επιβεβαιώθηκε περίτρανα στην πρόσφατη περιπέτεια της πανδημίας.   Η  διαχρονική πρωτοκαθεδρία του οργανισμού στην προετοιμασία των μαθητών για την τριτοβάθμια εκπαίδευση, ανεξαρτήτως του τρόπου εισαγωγής τους, καταδεικνύεται από τα αποτελέσματα, αφού κάθε χρόνο πάνω από 1200 μαθητές των  φροντιστηρίων μας εισάγονται στην Τριτοβάθμια Εκπαίδευση. Υπολογίζεται ότι πάνω από 60000 σημερινοί επιστήμονες πέρασαν από τα θρανία του όλα αυτά τα χρόνια!

Για περισσότερες πληροφορίες επισκεφθείτε το https://neo.edu.gr/

Αφήστε μια απάντηση

Η ηλ. διεύθυνση σας δεν δημοσιεύεται. Τα υποχρεωτικά πεδία σημειώνονται με *

Αλλαγή μεγέθους γραμματοσειράς